View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10640_low_23 (Length: 242)
Name: NF10640_low_23
Description: NF10640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10640_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 37953634 - 37953856
Alignment:
| Q |
1 |
ggaacccacatcttattgaagattaataatgagatgacggcgacggcgatgcatgatgatgataacgacttccttagattctatttatatacttgtgtca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37953634 |
ggaacccacatcttattgaagattaataatgagatgacg------gcgatgcatgatgatgattacgacttccttagattctatttatatacttgtgtca |
37953727 |
T |
|
| Q |
101 |
tcctctagatcttgattccgttcctttttccttaagatccagtcgagtgaaaagataactaaactatcaattgacgagccgaaaatttatgaactttgaa |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37953728 |
tcctctagatcttgattccattcctttttccttaagatccagtcgagtgaaaagataactaaactatcaattgacgagccgaaaatttaagaactttgaa |
37953827 |
T |
|
| Q |
201 |
tttgtcacagtaatgagtgtattgtgtct |
229 |
Q |
| |
|
||||||||| ||||||||||||||||||| |
|
|
| T |
37953828 |
tttgtcacattaatgagtgtattgtgtct |
37953856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University