View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10640_low_25 (Length: 230)
Name: NF10640_low_25
Description: NF10640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10640_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 37761449 - 37761226
Alignment:
| Q |
1 |
caaggttatggaattggaaattggtaaattgcagaagaaattggaagnnnnnnntgagcagcttcaggtttcaacctcttctgctgagaaggtttcaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37761449 |
caaggttatggaattggaaattggtaaattgcagaagaaattggaagaaaaaaatgagcagcttcaggtttcaacctcttctgctgagaaggtttcaatt |
37761350 |
T |
|
| Q |
101 |
tcatatactgtaccttattattat------tattcttttcatggtttatgaatatcttggtcgtatacagctgtttgatttgaaaattgaaatgtttcac |
194 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37761349 |
tcatatactgtaccttattattattattattattcttttcatggtttatgaatatcttggtcgtatacagctgtttgatttgaaaattgaaatgtttcca |
37761250 |
T |
|
| Q |
195 |
ctttttgttttgcacgattctcta |
218 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37761249 |
ctttttgttttgcacgattctcta |
37761226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University