View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10640_low_25 (Length: 230)

Name: NF10640_low_25
Description: NF10640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10640_low_25
NF10640_low_25
[»] chr1 (1 HSPs)
chr1 (1-218)||(37761226-37761449)


Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 37761449 - 37761226
Alignment:
1 caaggttatggaattggaaattggtaaattgcagaagaaattggaagnnnnnnntgagcagcttcaggtttcaacctcttctgctgagaaggtttcaatt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||    
37761449 caaggttatggaattggaaattggtaaattgcagaagaaattggaagaaaaaaatgagcagcttcaggtttcaacctcttctgctgagaaggtttcaatt 37761350  T
101 tcatatactgtaccttattattat------tattcttttcatggtttatgaatatcttggtcgtatacagctgtttgatttgaaaattgaaatgtttcac 194  Q
    ||||||||||||||||||||||||      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      
37761349 tcatatactgtaccttattattattattattattcttttcatggtttatgaatatcttggtcgtatacagctgtttgatttgaaaattgaaatgtttcca 37761250  T
195 ctttttgttttgcacgattctcta 218  Q
    ||||||||||||||||||||||||    
37761249 ctttttgttttgcacgattctcta 37761226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University