View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10640_low_5 (Length: 366)
Name: NF10640_low_5
Description: NF10640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10640_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 16 - 349
Target Start/End: Original strand, 44560929 - 44561262
Alignment:
| Q |
16 |
ccaacaatgtttctgaggtctcccctccactggactaccataaattgccgtaagaaacaaaactcgtcttccatgaaaaactacagaaaatcttttataa |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
44560929 |
ccaacaatgtttctgaggtcccccctccactggactaccataaattgccgtaagaaacaaaactcgtcttccatgaaaaactacggaaaatcttctataa |
44561028 |
T |
|
| Q |
116 |
agcaagaattatccaaaccccctgcttccacgctatcataatcccaccagagtaatctgtattctcggaaataacaaaaccatcaaaatccaacatcgta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44561029 |
agcaagaattatccaaaccccctgcttccacgctatcataatcccaccagagtaatctgtattctcggaaataacaaaaccatcaaaatccaacatcgta |
44561128 |
T |
|
| Q |
216 |
atagatcttttaatctttagaggatgggtacgcaactccataagaatcataacttcagggtagtaagaattcacaagtattcattgaagttttgtaattt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44561129 |
atagatcttttaatctttagaggatgggtacgcaactccataagaatcataacttcagggtagtaagaattcacaagtattcattgaagttttgtaattt |
44561228 |
T |
|
| Q |
316 |
gagtccaaacaagaaacaagtattgtcatttgat |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44561229 |
gagtccaaacaagaaacaagtattgtcatttgat |
44561262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University