View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10640_low_7 (Length: 356)
Name: NF10640_low_7
Description: NF10640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10640_low_7 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 1 - 356
Target Start/End: Original strand, 5836809 - 5837164
Alignment:
| Q |
1 |
tcacaagtggagcaaagagaagcagcatcagctttacaaagaaaagccgccggggcacgctcgcaggcttcacagacccagacgcgctcgtgcctcgagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
5836809 |
tcacaagtggagcaaagagaagcagcatcagctttacaaagaaaagccgccggggcacgctcgcaggcctcacagacccagacgcgttcgtgcctcgagg |
5836908 |
T |
|
| Q |
101 |
ctacacggtttgccgcgtggatgcgtgcatcacacgcggcacataaatatgccgagtctgcgcggcagaaaaccgcgcatggggccgagcggcacgtgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5836909 |
ctacacggtttgccgcgtggatgcgtgcatcacacgcggcacataaatatgccgagtctgcgcggcagaaaaccgcgcatggggccgagcggcacgtgtc |
5837008 |
T |
|
| Q |
201 |
acatgttcgtgcccacgttgccgcagaccttacggtgactgtggccgaggtggtggtgaggaaatcttgctccaacatttgtggagagagggagtgatga |
300 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5837009 |
acatgttcgtgcccacgttcccgcagaccttacagtggctgtggctgaggtggtggtgaggaaatcttgctccaacatttgtggagagagggagtgatga |
5837108 |
T |
|
| Q |
301 |
atggtttgtttgtcagttttggacagacagtgttaaggaagttcaaataggtgaag |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5837109 |
atggtttgtttgtcagttttggacagacagtgttaaggaagttcaaataggtgaag |
5837164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University