View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10641_high_11 (Length: 216)
Name: NF10641_high_11
Description: NF10641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10641_high_11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 42651834 - 42651784
Alignment:
| Q |
166 |
tgatgaaaatacttgaatgttgattgttgtttgtccatgtctctaaattca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42651834 |
tgatgaaaatacttgaatgttgattgttgtttgtccatgtctctaaattca |
42651784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University