View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10641_high_5 (Length: 390)
Name: NF10641_high_5
Description: NF10641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10641_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 6e-87; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 204 - 378
Target Start/End: Complemental strand, 17770993 - 17770819
Alignment:
| Q |
204 |
ctgtcagccgaaatcaaaaggttacaagctcaaaaagacaccatttatcattaattgtttcaactttctgttttaccacatcctttctttctgttatata |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
17770993 |
ctgtcagccgaaatcaaaaggttacaagctcaaaaagacaccatttatcattatttgtttcaactttctattttaccacatcctttctttcttttatata |
17770894 |
T |
|
| Q |
304 |
aatcacttttcctcacttgcttctctcttaaatctcttcaccctctatcacaaccaatctcttattaacccttca |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17770893 |
aatcacttttcctcacttgcttctctcttaaatctcttcaccctctatcacaaccaatctcttattaacccttca |
17770819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 92 - 140
Target Start/End: Complemental strand, 17771105 - 17771057
Alignment:
| Q |
92 |
ccaaaaccaaccagcaccctgcagaaagccatcgctgtccgtcccaaca |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17771105 |
ccaaaaccaaccagcaccctgcagaaagccatcgttgtccgtcccaaca |
17771057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 23 - 79
Target Start/End: Complemental strand, 17771181 - 17771125
Alignment:
| Q |
23 |
ctgcctcacctcctaaactcagacacgcctagccctactactcaaccacgccgctgt |
79 |
Q |
| |
|
|||||| |||||||||||| |||||| ||||||||||||||||| ||| |||||||| |
|
|
| T |
17771181 |
ctgccttacctcctaaacttagacacacctagccctactactcagccatgccgctgt |
17771125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 6e-22; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 251 - 320
Target Start/End: Complemental strand, 41066821 - 41066752
Alignment:
| Q |
251 |
tcattaattgtttcaactttctgttttaccacatcctttctttctgttatataaatcacttttcctcact |
320 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41066821 |
tcattaattgtcccaactttctgttttacaacatcctttctttcttttatataaatcacttttcctcact |
41066752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 326 - 371
Target Start/End: Complemental strand, 41066729 - 41066684
Alignment:
| Q |
326 |
ctctcttaaatctcttcaccctctatcacaaccaatctcttattaa |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
41066729 |
ctctcttaaatctcttcaccctctatcacagccaatctcttcttaa |
41066684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 286 - 378
Target Start/End: Original strand, 5391726 - 5391810
Alignment:
| Q |
286 |
ctttctttctgttatataaatcacttttcctcacttgcttctctcttaaatctcttcaccctctatcacaaccaatctcttattaacccttca |
378 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
5391726 |
ctttctttcttttatataaatcacttttcct--------tctctcttaaatcaattcaccctctatcacaaccaatctcttcttaagccttca |
5391810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University