View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10641_high_8 (Length: 244)
Name: NF10641_high_8
Description: NF10641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10641_high_8 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 16700267 - 16700492
Alignment:
| Q |
19 |
agttgtgtctacttcatactgcttcaatgatcaataagcaacataagcaagagtaatcatgaatggtgaaaactcactgagtggagcaggagggttccag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16700267 |
agttgtgtctacttcatactgcttcaatgatcaataagcaacatatgcaagagtaatcatgaatggtgaaaacttactgagtggagcaggagggttccag |
16700366 |
T |
 |
| Q |
119 |
cacggttttagtgctttatcattttgcttcaatggctttttggttagatgtgaaacggttgccatgttttcttgagtaactgttacagagtcttgttggg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16700367 |
cacggttttagtgctttatcattttgcttcaatggctttttggtaagatgtgaaacggttgccatgttttcttgagtaactgttacagagtcttgttggg |
16700466 |
T |
 |
| Q |
219 |
aaacttctgtagcttgaacttcaatc |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
16700467 |
aaacttctgtagcttgaacttcaatc |
16700492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University