View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10641_low_19 (Length: 295)
Name: NF10641_low_19
Description: NF10641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10641_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 18 - 284
Target Start/End: Complemental strand, 31161462 - 31161193
Alignment:
| Q |
18 |
ctcttgtcataattctcaagtcacaaaaaacaagaacgtgt-----tttcatnnnnnnnnnncttttaaataactctagaaaacaacgctgtcatctggt |
112 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31161462 |
ctcttgtcataattctcaagttacaaaaaacaagaacgtgtagggttttcataaaaaaaaaacttttaaataactctagaaaacaacgctgtcatctggt |
31161363 |
T |
|
| Q |
113 |
gagttcggacctgttgccaagcaatacaatacaaaaatgcgcaacttcaaagaccatcctttggtgagcacaaactcgtcaccaaacaagatgaaacaga |
212 |
Q |
| |
|
|||||| || |||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31161362 |
gagttcagatctgttgccaagcgatacaatacaaaaatgcgcaacttcaaa--ccatcgtttggtgagcacaaactcgtcaccaaccaagatgaaacaga |
31161265 |
T |
|
| Q |
213 |
agctacaagctcaattttatcgtgagacgagattaggcggaaacacaaggtcctttgcatttctttctctct |
284 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31161264 |
agctacaagctcaattttatcgtgagatgagattaggcggaaacacaaggtcctttgcatttctttctctct |
31161193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University