View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10641_low_21 (Length: 276)
Name: NF10641_low_21
Description: NF10641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10641_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 4 - 260
Target Start/End: Original strand, 2239279 - 2239539
Alignment:
| Q |
4 |
cagtaaacttttgttat----tctatttattcgttggaaaacatcattgtagatataacattggcgaacaatttgatacttgtgtagggatggtggtgac |
99 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2239279 |
cagtaaacttttgttatgtattctatttattcgttggaaaacatcattgtagatataacatcggcgaacaatttgatacttgtgtagggatggtggtgac |
2239378 |
T |
|
| Q |
100 |
ttctttgaacttgttaccatgtgggagactagaaggagggcgaatagcgcaagccatgtttggtcgaagcactgctacattgttatcttttggtacatcg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2239379 |
ttctttgaacttgttaccatgtgggagactagaaggagggcgaatagcgcaagccatgtttggtcgaagcactgcgacattgttatcttttggtacatcg |
2239478 |
T |
|
| Q |
200 |
ttattgcttggtattggcggccttagtggtagtgttttgtgccttgcatggggattgtttg |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2239479 |
ttattgcttggtattggcggccttagtggtagtgttttgtgccttgcatggggattgtttg |
2239539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University