View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10641_low_22 (Length: 268)
Name: NF10641_low_22
Description: NF10641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10641_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 9 - 253
Target Start/End: Original strand, 35685471 - 35685708
Alignment:
| Q |
9 |
agcagagaaaacttggatcctttgaaaagtttaattttgtggtataaatgcttttttattataactcttttacaatctttctgatttggtttctttgttg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35685471 |
agcagagaaaacttggatcctttgaaaagtttaattttgtggtatgaatgcttttttattattactcttttacaatcattctgatttggtttctttgttg |
35685570 |
T |
 |
| Q |
109 |
ttggagtgtttttgaagctaagttcagggagtatgaaagataaaaatgacnnnnnnnnnnnnnnnngaatattttaataaaaaggcttacccaaaataat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35685571 |
ttggagtgtttttgaagctaagttcagggagtatgaaagataaaaatga-------ttttttttttgaatattttaataaaaaggcttacccaaaataat |
35685663 |
T |
 |
| Q |
209 |
gggttgagagagcataagcttaataaagagataaagtgacatcaa |
253 |
Q |
| |
|
||||| |||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
35685664 |
gggttaagagagcataagcttaataaagggacaaagtgacatcaa |
35685708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University