View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10641_low_26 (Length: 257)
Name: NF10641_low_26
Description: NF10641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10641_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 17 - 246
Target Start/End: Complemental strand, 7452335 - 7452106
Alignment:
| Q |
17 |
agtatgatgtcaaaaacgtaatggaaatggatacaactaaatgagaaagatgcattttggtgtggcttttattatctgcatatggcagcaataatgatac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7452335 |
agtatgatgtcaaaaacgtaatggaaatggatacaactaaatgagaaagatgcattttggtgtggcttttattatctgcatatggtagcaataatgatac |
7452236 |
T |
|
| Q |
117 |
attccttcattaatgtgtggaataagagagttgacaataaagtttcgattcttcccttnnnnnnntgaaagtttcaaatctatagaagatttgtagcata |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7452235 |
attccttcattaatgtgtggaataagagagttgacaataaagtttcgattcttcccttaaaaaaatgaaagtttcaaatctatagaagatttgtagcata |
7452136 |
T |
|
| Q |
217 |
gaaaatcaaaataataccacccacgtctct |
246 |
Q |
| |
|
||||||||||||| |||||||||||||||| |
|
|
| T |
7452135 |
gaaaatcaaaatactaccacccacgtctct |
7452106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University