View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10641_low_27 (Length: 252)
Name: NF10641_low_27
Description: NF10641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10641_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 13 - 194
Target Start/End: Original strand, 42650573 - 42650756
Alignment:
| Q |
13 |
cagagagaaattgtgaaaagcttgagtttttgcttgaatctctaattttgtgtagtaatgaatgaaa--tgtaatttcaccttgcatggtatttatagca |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
42650573 |
cagagagccattgtgaaaagcttgagtttttgcttgaatctctaattttgtgtagtaatgaatgaaaaatgtaatttcactttgcatggtatttatagca |
42650672 |
T |
|
| Q |
111 |
atgttattatccattgcctatgttgtcacacttttttccttttaaggcaggtgacaggctttttgtgagtgaagggaatgtagt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
42650673 |
atgttattatccattgcctatgttgtcacacttttttccttttaaggcaggcgacaggctttttgtgtgtgaagggaatgtagt |
42650756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 208 - 252
Target Start/End: Original strand, 42651620 - 42651664
Alignment:
| Q |
208 |
cccagaaagtgcttatagggaaaatatgaaaaaattaatcaagac |
252 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42651620 |
cccagaaagtgcttatagggaaaatatggaaaaattaatcaagac |
42651664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University