View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10641_low_30 (Length: 247)
Name: NF10641_low_30
Description: NF10641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10641_low_30 |
 | |
|
| [»] scaffold1246 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1246 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: scaffold1246
Description:
Target: scaffold1246; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 22 - 237
Target Start/End: Complemental strand, 1901 - 1686
Alignment:
| Q |
22 |
acacattattttctcattattcatttaacattctaaacctttaacttttttaatcctagttttggtaagaaaacaatatagaaacagcatatggagctgg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
1901 |
acacattattttctcattattcatttaatattctaaacctttaacttttttaatcctagttttggcaagaaaacaatatagaaacatcatatggagctgg |
1802 |
T |
|
| Q |
122 |
aattaggactcaaaattactaaaactaaagatgacattgattccatttcagagtataaacttatgaaggatacaggaccaatctttcaatctagagaaac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1801 |
aattaggactcaaaattactaaaactaaagatgacattgattccatttcagagtataaacttatgaaggatacaggaccaatctttcaatctagagaaac |
1702 |
T |
|
| Q |
222 |
aaacaccatgttcatc |
237 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1701 |
aaacaccatgttcatc |
1686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University