View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10641_low_34 (Length: 240)
Name: NF10641_low_34
Description: NF10641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10641_low_34 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 15 - 240
Target Start/End: Complemental strand, 15595764 - 15595539
Alignment:
| Q |
15 |
attctcatccttgacccaccatcatggtagcttatcttctttcatccattaacttattgaaccttgttaacttatcattccttctttaattccctagaat |
114 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||| ||||||||||||||| |||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
15595764 |
attctcatcctcgacccaccatcatggtagcttgacttcaatcatccattaacttactgaaccttcttaacttattattccttctttaattccctagaat |
15595665 |
T |
 |
| Q |
115 |
cgagagatcacatctcgtttcaatccaccctaaagattctattttccacttactgttgcacttgtgttttcttagtccatccaacttactgcctcatgat |
214 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
15595664 |
cgagagatcacctctcgtttcaatccaccctaaagattctattttccacttactgttgcacttgtgttttcttagtccacccaacttactacctcatgaa |
15595565 |
T |
 |
| Q |
215 |
aaatactggagaaatctgattccatc |
240 |
Q |
| |
|
||||||| |||||||||||||||||| |
|
|
| T |
15595564 |
aaatactagagaaatctgattccatc |
15595539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University