View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10641_low_35 (Length: 240)
Name: NF10641_low_35
Description: NF10641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10641_low_35 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 8375803 - 8375581
Alignment:
| Q |
18 |
catattgttgaatcacttgttgctacccgtaatgtcccggtcgcacaaaacagtcctgagttgcaagcaatatagacgccggttgcaagtacttttgcag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8375803 |
catattgttgaatcacttgttgctacccctaatgtcacggtcgcacaaaacagtcccgagttgcaagcaatatagacaccggttgcaagtacttttgcag |
8375704 |
T |
|
| Q |
118 |
caagggtctcgaattccttcagttttgccgtacaaaatgtgtctgatgtaattcctcatggggctctcacttagtcggctagtcctatgttggaattggt |
217 |
Q |
| |
|
||||| ||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
8375703 |
caaggttctcgaattcctttagttttgccctacaaaatgtgtctgatgtaattcctcatggggctctcccttagtcgactagtcctatgttggaattggt |
8375604 |
T |
|
| Q |
218 |
tccccaagtgatattccccccgt |
240 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
8375603 |
tccctaagtgatattccccccgt |
8375581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 129 - 226
Target Start/End: Complemental strand, 18145434 - 18145337
Alignment:
| Q |
129 |
aattccttcagttttgccgtacaaaatgtgtctgatgtaattcctcatggggctctcacttagtcggctagtcctatgttggaattggttccccaagt |
226 |
Q |
| |
|
||||| |||||||||| ||||| |||||||||||| ||||||||||| || | | || || || |||||||| ||||||||||| |||||||||| |
|
|
| T |
18145434 |
aattctttcagttttgaactacaagatgtgtctgatgaaattcctcatgtggatttgcctgagacgactagtcctgtgttggaattgattccccaagt |
18145337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University