View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10641_low_43 (Length: 217)
Name: NF10641_low_43
Description: NF10641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10641_low_43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 26 - 199
Target Start/End: Original strand, 29680876 - 29681049
Alignment:
| Q |
26 |
atataaatataatggttcaagttgaagatggcgagtcattggatctgaagggtctcggccttaccgtcggggaccgaaaacatcttgcatggtggggaac |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29680876 |
atataaatataatggttcaagttgaagatggcgagtcattggatctgaagggtctcggccttaccgtcggggaccgaaaacatcttgcatggtggggaac |
29680975 |
T |
|
| Q |
126 |
tttgttcctttggtgttgttattggcatcaccggttctctctctaggaggtggcctaataccaaaaatcttatc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29680976 |
tttgttcctttggtgttgttattggcatcaccggttctctctctaggaggtggcctaataccgaaaatcttatc |
29681049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 26 - 199
Target Start/End: Original strand, 29667516 - 29667689
Alignment:
| Q |
26 |
atataaatataatggttcaagttgaagatggcgagtcattggatctgaagggtctcggccttaccgtcggggaccgaaaacatcttgcatggtggggaac |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29667516 |
atataaatataatggttcaagttgaagatggcgagtcattggatctgaagggtcttggccttaccgtcggggagcgaaaacatcttgcatggtggggaac |
29667615 |
T |
|
| Q |
126 |
tttgttcctttggtgttgttattggcatcaccggttctctctctaggaggtggcctaataccaaaaatcttatc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29667616 |
tttgttcctttggtgttgttattggcatcaccggttctctctctaggaggtggcctaataccgaaaatcttatc |
29667689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 18 - 193
Target Start/End: Original strand, 29686668 - 29686842
Alignment:
| Q |
18 |
agacgtagatataaatataatggttcaagttgaagatggcgag--tcattggatctgaagggtctcggccttaccgtcggggaccgaaaacatcttgcat |
115 |
Q |
| |
|
|||| ||||||||||||||| ||| |||||||||||||||||| || |||||||| ||||| ||||||| || ||| ||||||||||||||||||| |
|
|
| T |
29686668 |
agacctagatataaatataacggtgcaagttgaagatggcgagagtccttggatctt---ggtcttggccttatcgccggtgaccgaaaacatcttgcat |
29686764 |
T |
|
| Q |
116 |
ggtggggaactttgttcctttggtgttgttattggcatcaccggttctctctctaggaggtggcctaataccaaaaat |
193 |
Q |
| |
|
||| ||||||||| || || |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29686765 |
ggtagggaacttttttttgttcgtgttgttattggcatcaccggttctctctctaggaggtggcctaataccgaaaat |
29686842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 120 - 192
Target Start/End: Complemental strand, 29690442 - 29690370
Alignment:
| Q |
120 |
gggaactttgttcctttggtgttgttattggcatcaccggttctctctctaggaggtggcctaataccaaaaa |
192 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||| || ||||||||| | ||||||||| |||| |||| |
|
|
| T |
29690442 |
gggaacttagtacctttggttttgttattggcatcaccagtgctctctctacggggtggcctattaccgaaaa |
29690370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 120 - 181
Target Start/End: Complemental strand, 29719146 - 29719085
Alignment:
| Q |
120 |
gggaactttgttcctttggtgttgttattggcatcaccggttctctctctaggaggtggcct |
181 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||| || ||||||||| | |||||||| |
|
|
| T |
29719146 |
gggaacttagtacctttggttttgttattggcatcaccagtgctctctctatggggtggcct |
29719085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University