View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10641_low_44 (Length: 216)

Name: NF10641_low_44
Description: NF10641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10641_low_44
NF10641_low_44
[»] chr5 (1 HSPs)
chr5 (166-216)||(42651784-42651834)


Alignment Details
Target: chr5 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 42651834 - 42651784
Alignment:
166 tgatgaaaatacttgaatgttgattgttgtttgtccatgtctctaaattca 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
42651834 tgatgaaaatacttgaatgttgattgttgtttgtccatgtctctaaattca 42651784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University