View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10641_low_46 (Length: 205)
Name: NF10641_low_46
Description: NF10641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10641_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 12 - 188
Target Start/End: Complemental strand, 39635994 - 39635818
Alignment:
| Q |
12 |
caaaggtaaactgaacaatagatctaagatcatcccaattctcatttgcaaatgcatcatccaaaacattttgatcattccaaaaacttgagtgagacaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39635994 |
caaaggtaaactgaacaatagatctaagatcatcccaattctcatttgcaaatgcatcatccaaaacattttgatcattccaaaaacttgagtgagacaa |
39635895 |
T |
|
| Q |
112 |
ggttgttgttggaacttgtgctgcattgcctaattgatttagaaatgagttgttaaatctttggtcaacaacatgtc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39635894 |
ggttgttgttggaacttgtgctgcattgcctaattgatttagaaatgagttgttaaatctttggtcaacaacatgtc |
39635818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University