View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10641_low_47 (Length: 203)
Name: NF10641_low_47
Description: NF10641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10641_low_47 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 39060629 - 39060440
Alignment:
| Q |
1 |
cgaactggaaaatctttttacttcttcgttatcttggacactacctcaatgaaaggctctttcatagcagcagaatgattctctgaataatttatgactg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39060629 |
cgaactggaaaatctttttacttcttcgttatcttggacactacctcaatgaaaggctctttcatagcagcagaatgattctctgaataatttatgattg |
39060530 |
T |
|
| Q |
101 |
catgatctccaagtcatgaacaacgttgggatttaaaatatctaaaatttaatccaaacatgtcacttcatcactccaaaggtctctgct |
190 |
Q |
| |
|
||| |||||||| |||||| ||||||||| |||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39060529 |
cataatctccaaatcatgagcaacgttggaatttaagatatctaaaatataatccaaacatgtcacttcatcactccaaaggtcactgct |
39060440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 32 - 95
Target Start/End: Complemental strand, 21514947 - 21514884
Alignment:
| Q |
32 |
tcttggacactacctcaatgaaaggctctttcatagcagcagaatgattctctgaataatttat |
95 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||| ||||| | |||||||||| |
|
|
| T |
21514947 |
tcttggagactacctcaatgaaaggctcttccatagcagcagaacaattctttaaataatttat |
21514884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 95
Target Start/End: Original strand, 13711465 - 13711557
Alignment:
| Q |
3 |
aactggaaaatctttttacttcttcgttatcttggacactacctcaatgaaaggctctttcatagcagcagaatgattctctgaataatttat |
95 |
Q |
| |
|
|||| ||||| | |||| |||||| || |||||||||| ||||||| ||||||||||| ||| || ||||| |||||| | |||||||||| |
|
|
| T |
13711465 |
aactagaaaacccttttgcttcttgtttttcttggacaccacctcaaagaaaggctcttcaataacaacagaacgattctttaaataatttat |
13711557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University