View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10641_low_6 (Length: 395)
Name: NF10641_low_6
Description: NF10641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10641_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 11 - 374
Target Start/End: Original strand, 35326996 - 35327358
Alignment:
| Q |
11 |
cagagattcagagaaaccagcctccaccaggttcccttatatgcatctctctctatctcaaacaaacatgcatgcat----gcatgcagtaataaggaac |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35326996 |
cagagattcagagaaaccagcctccaccaggttcccttatatgcatctctctctatctcaaacaaacatgcatgcatacatgcatgcagtaataaggaac |
35327095 |
T |
|
| Q |
107 |
ttacctttcattttttcatgatttcaggatacccaactgaccaggatccccccacaaaaagaaagctgttcgttagtacaaagaagaaaggagatagggg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35327096 |
ttacctttcattttttcatgatttcaggatacccaactgaccaggatccccccacaaaaagaaagctgttcattagtacaaagaagaaaggagatagggg |
35327195 |
T |
|
| Q |
207 |
cttcattgagggatggtaagcttctgaagggaaaggcacagagattaagcttctgtttagttaatgacttggttcaaacaagtcattaaccacaaaagcc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||| |
|
|
| T |
35327196 |
cttcattgagggatggtaagcttctgaagggaaaggcacagagattaagcttctgtttagttaatgacttggttcaaa------ataatccacaaaagcc |
35327289 |
T |
|
| Q |
307 |
ttcaaacaaatttatttgcataaccacttat-ctttttatttatgatgcagcctctttgctctatgctg |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35327290 |
ttcaaacaaatttatttgcataaccacttatcctttttatttatgatgcagcctctttgctctgtgctg |
35327358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University