View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10642_high_2 (Length: 289)
Name: NF10642_high_2
Description: NF10642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10642_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 20 - 247
Target Start/End: Original strand, 39642102 - 39642329
Alignment:
| Q |
20 |
ggcaaaaccgagttgcatggcaaaaacaaggtaagaagagaagagaaggtaggtgttgtcaacggcataggttgtgtcaatgaatttgtttgcaacggca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39642102 |
ggcaaaaccgagttgcatggcaaaaacaaggtaagaagagaagagaaggtaggtgttgtcaacggcataggttgtgtcaatgaatttgtttgcaacggca |
39642201 |
T |
|
| Q |
120 |
ttaaagccgttgcagatgtattcggcagcggctgtggaatttgcaccgctgccgaggagagcgttgaggtcggaggcggagcaggtgaaagaagccatcg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39642202 |
ttaaagccgttgcagatgtattcggcagcggctgtggaatttgcaccactgccgaggagagtgttgaggtcggaggcggagcaggtgaaagaagccatcg |
39642301 |
T |
|
| Q |
220 |
tgaactgaactagaatataggatctgtg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
39642302 |
tgaactgaactagaatataggatctgtg |
39642329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 21 - 217
Target Start/End: Original strand, 46670300 - 46670496
Alignment:
| Q |
21 |
gcaaaaccgagttgcatggcaaaaacaaggtaagaagagaagagaaggtaggtgttgtcaacggcataggttgtgtcaatgaatttgtttgcaacggcat |
120 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||| |||||||| |||||||| || ||||||| ||||| |||||||||||||| ||||||| |
|
|
| T |
46670300 |
gcaaaacctagttgcatggcaaaaacaaggtaagctgagaatagaaggtaagtgttgtcgacagcataggaagtgtcgatgaatttgtttgcgacggcat |
46670399 |
T |
|
| Q |
121 |
taaagccgttgcagatgtattcggcagcggctgtggaatttgcaccgctgccgaggagagcgttgaggtcggaggcggagcaggtgaaagaagccat |
217 |
Q |
| |
|
| |||||| |||||||||||||||||||||||||| ||||| | | |||||||||||||| ||||||||||||||| |||||||||| |||||| |
|
|
| T |
46670400 |
tgaagccgccacagatgtattcggcagcggctgtggagtttgcgcttccgccgaggagagcgtggaggtcggaggcggaacaggtgaaagtagccat |
46670496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University