View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10642_low_11 (Length: 239)
Name: NF10642_low_11
Description: NF10642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10642_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 126 - 224
Target Start/End: Complemental strand, 12585563 - 12585465
Alignment:
| Q |
126 |
agtcattttgaataaatcattctcttgtaattttcaaatcaattagttgtttatgtcattaatttcttcactaacaggacattttgtctagtttttggt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12585563 |
agtcattttgaataaatcattctcttgtaattttcaaatcaattagttgtttatgtcattaatttcttcactaacgggacattttgtctagtttttggt |
12585465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 126 - 224
Target Start/End: Original strand, 28633184 - 28633282
Alignment:
| Q |
126 |
agtcattttgaataaatcattctcttgtaattttcaaatcaattagttgtttatgtcattaatttcttcactaacaggacattttgtctagtttttggt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||||||||| |
|
|
| T |
28633184 |
agtcattttgaataaatcattctcttgtaattttcaaatcaattagttgtttatgtcattaatttcttaactaacgggacattttgtatagtttttggt |
28633282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University