View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10642_low_12 (Length: 235)
Name: NF10642_low_12
Description: NF10642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10642_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 79 - 220
Target Start/End: Complemental strand, 13983212 - 13983071
Alignment:
| Q |
79 |
cttcattggttcttctctcgtagccctctttcatttctcctatgtgttgttttacctttaggtcttaaatgagatattggttatatctattgtttataaa |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13983212 |
cttcattggttcttctctcgtagctctctttcatttctcctatgtgttgttttacttttaggtcttaaatgagatcttggttatatctattgtttataaa |
13983113 |
T |
|
| Q |
179 |
tttaattatacatcacttgttttcttgatttttaatagaact |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13983112 |
tttaattatacatcacttgttttcttgatttttaatagaact |
13983071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University