View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10642_low_2 (Length: 377)
Name: NF10642_low_2
Description: NF10642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10642_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 106 - 368
Target Start/End: Complemental strand, 35212315 - 35212052
Alignment:
| Q |
106 |
tagcacatccttgatttatatattgagttcaatgatttctaaaccaatctagtaagatataattgaatttt-gtgcatagtcattaaactcatattttaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35212315 |
tagcacatccttgatttatatattgagttcaatgatttctaaaccaatctagtaagatataattgaattttagtgcatagtcattaaactcatattttaa |
35212216 |
T |
|
| Q |
205 |
ccaattacattaatgtctcttaagtcttacccctgcaggaaagatcacggatcctattgcgtgttgctgatttggttgagaaacacaacgatgaacttgc |
304 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35212215 |
ccgattacattaatgtctcttaagtcttacccctgcaggaaagatcacggatcctattgcgtgttgctgatttggttgagaaacacaacgatgaacttgc |
35212116 |
T |
|
| Q |
305 |
ggcattggaaacatggaataacggcaagctttatgagcaagctgtaaatattgaagtgcctatg |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35212115 |
ggcattggaaacatggaataacggcaagctttatgagcaagctgtaaatattgaagtgcctatg |
35212052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 19 - 83
Target Start/End: Complemental strand, 35212379 - 35212315
Alignment:
| Q |
19 |
acaaatgacttactattatggtccttttaaactaaagtggttttacaccttaaactgtgatttct |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35212379 |
acaaatgacttactattatggtccttttaaactaaagtggttttacacctgaaactgtgatttct |
35212315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University