View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10642_low_7 (Length: 278)
Name: NF10642_low_7
Description: NF10642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10642_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 39 - 261
Target Start/End: Original strand, 42290320 - 42290543
Alignment:
| Q |
39 |
caaaaaccatacctgggttgtattgtatctaaaaaatcaccattgacataagatcaaagtgatcgtaaagtgagaaatttgaaggtgaagagagagaagg |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42290320 |
caaaaaccatacctgggttgtattgtatctaaaaaatcaccattgacataagatcaaagtgatcgtaaagtgagaaatttgaaggtgaagagagagaagg |
42290419 |
T |
 |
| Q |
139 |
gttaaaagggtaaatataaagaaggttgttttaacgcagcactgactttttggtgagaataacgttgttgttctagttttgatgtgtt-gggttgtgaaa |
237 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42290420 |
gttaaaagggtaattataaagaaggttgttttaacgcagcactgactttttggtgagaataacgttgttgttctagttttgatgtgttggggttgtgaaa |
42290519 |
T |
 |
| Q |
238 |
gtgatgacgatgaaggtatcaaag |
261 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42290520 |
gtgatgacgatgaaggtatcaaag |
42290543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University