View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10643_low_10 (Length: 232)
Name: NF10643_low_10
Description: NF10643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10643_low_10 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 232
Target Start/End: Complemental strand, 6177143 - 6176928
Alignment:
| Q |
17 |
atattgatgatgagctgagaatagggtggttgtgttgtaaaaagtaaaaattagtgtaagggtgggacctaaagtgcagtaaataaaagagatacaaacc |
116 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6177143 |
atattgatgatgggctgagaatagggtggttgtgttgtaaaaagtaaaaattagtgtaagggtgggacctaaagtgcagtaaataaaagagatacaaacc |
6177044 |
T |
|
| Q |
117 |
tgtacttggagctgaagctgtttaaggtattcaatagcttcatctagcattgaagctttatcagtctgtcacacacatggaaacaatccactacattaag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6177043 |
tgtacttggagctgaagctgtttaaggtattcaatagcttcatctagcattgaagctttatcagtctgtcacacacatggaaacaatccactacgttaag |
6176944 |
T |
|
| Q |
217 |
aatactaattctaatt |
232 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
6176943 |
aataataattctaatt |
6176928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University