View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10643_low_12 (Length: 207)
Name: NF10643_low_12
Description: NF10643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10643_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 31088313 - 31088459
Alignment:
| Q |
1 |
cccaccgcaagcttcaaacaaacgggaatcgaaagcttcgtacaaaagttgcaataattttagagtacaaaaaagctcatcaacgactttcgagatgcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| || |
|
|
| T |
31088313 |
cccaccgcaagcttcaaacaaacgggaatcgaaagcttcgtacaaaagttgcaataattttacagtacaaaaaagctcatcaacgacttccgagatatta |
31088412 |
T |
|
| Q |
101 |
atccacgttctctcttttttcccaattgaagaaccattcagaactag |
147 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
31088413 |
atccacgttctctcttttctcccaattgaagaagcattcagaactag |
31088459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University