View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10645_low_5 (Length: 239)
Name: NF10645_low_5
Description: NF10645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10645_low_5 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 15 - 239
Target Start/End: Original strand, 2230133 - 2230359
Alignment:
| Q |
15 |
gttctttcattgaaacaaaattttctccacacacaacatcaaggaatcg--ctcgattccaaacccttggaccaatctatcattgttggttgaacttaat |
112 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
2230133 |
gttctttcattcaaacaaaattttctccacacacaacatcaaggaatcaaactcgattccaaacccttggaccaatctattatttttggttgaacttaat |
2230232 |
T |
|
| Q |
113 |
tgaatcacatgcttaaagtgcacatgtgaggagggcaacaacatggtagatatagtaaaacaactttgatattgaaacacacatgtgacgatacggtgca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2230233 |
tgaatcacatgcttaaagtgcacatgtgaggagggcaacaacatggtagatatagtaaaacaactttgatattgaaacacacatgtgacgatacggtgca |
2230332 |
T |
|
| Q |
213 |
atgttcatcacatttatacggtggacc |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2230333 |
atgttcatcacatttatacggtggacc |
2230359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University