View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10646_low_15 (Length: 247)
Name: NF10646_low_15
Description: NF10646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10646_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 36518202 - 36518432
Alignment:
| Q |
1 |
agacatggtttaatgcatttgttgagaattcgtttttgcgattggttaataatccaaacttactggtgtttcatgttttctggtgtgagggttcggctgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36518202 |
agacatggtttaatgcatttgttgagaattcgtttttgcaattggttaataatccaaacttactggtgtttcatgttttctggtgtgagggttcggctgc |
36518301 |
T |
|
| Q |
101 |
tgtttgtgcagtggttctgtttttggggtagttagtttggttatatcaagcttaggctagttatgttcctactgtattggttgttgtctgttttagcagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36518302 |
tgtttgtgcagtggttctgtttttggggtagttagtttggttatatcaagcttaggctagttatgttcctactgtattggttgttgtctgttttagcagg |
36518401 |
T |
|
| Q |
201 |
gtagtgatgtggtgtaggcacatttcctttg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36518402 |
atagtgatgtggtgtaggcacatttcctttg |
36518432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 121 - 231
Target Start/End: Complemental strand, 10727777 - 10727666
Alignment:
| Q |
121 |
ttttggggtagttagtttggtt-atatcaagcttaggctagttatgttcctactgtattggttgt-tgtctgttttagcagggtagtgatgtggtgtagg |
218 |
Q |
| |
|
||||||| |||||||||||||| ||| |||||||||||||||||||||||| ||| |||| ||| |||||||||| ||||||||||| ||||||||||| |
|
|
| T |
10727777 |
ttttgggctagttagtttggtttatagcaagcttaggctagttatgttccttttgt-ttggctgtctgtctgttttggcagggtagtgttgtggtgtagg |
10727679 |
T |
|
| Q |
219 |
cacatttcctttg |
231 |
Q |
| |
|
||||||||||||| |
|
|
| T |
10727678 |
cacatttcctttg |
10727666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 59 - 122
Target Start/End: Complemental strand, 10727891 - 10727828
Alignment:
| Q |
59 |
cttactggtgtttcatgttttctggtgtgagggttcggctgctgtttgtgcagtggttctgttt |
122 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
10727891 |
cttactggtgttttctgtcttctggtgtgagggttcggctactgtttgtgcagcggttctgttt |
10727828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University