View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10646_low_20 (Length: 224)
Name: NF10646_low_20
Description: NF10646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10646_low_20 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 25378164 - 25378387
Alignment:
| Q |
1 |
taacttaactaaagtttaacaaccatttcggtctcacaaaatctgagaaagttgtacgtaaaagatttagctgttcatttaagtctcaaaatcagagatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25378164 |
taacttaactaaagtttaacaaccatttcggtctcacaaaatccgagaaaattatacgtaaaagatttagttgttcatttaagtctcaaaatcagagatg |
25378263 |
T |
|
| Q |
101 |
ttggtattcaaaattgcacgcgaaagatatcaaatttagaaaaagtaacaataacactaacataacaaaatgttgcataatttcatgcaaagtccaaacc |
200 |
Q |
| |
|
| |||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25378264 |
taggtattcaaagttgcacgcgaaagatatcaaatttaaaaaaagtaacaataacactaaaataacaaaatgttgcataatttcatgcaaagtccaaacc |
25378363 |
T |
|
| Q |
201 |
cataggacaaaacaaacaaaccat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
25378364 |
cataggacaaaacaaacaaaccat |
25378387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University