View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10646_low_21 (Length: 209)
Name: NF10646_low_21
Description: NF10646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10646_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 87 - 164
Target Start/End: Original strand, 25378436 - 25378513
Alignment:
| Q |
87 |
caagactaaacaatccaaattaatgtcaaatgcatactaccatgctatagtggaagcatggtttatcaaacgtggaag |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25378436 |
caagactaaacaatccaaattaatgtcaaatgcatactaccatgctatagtggaagcatggtttatcaaacgtggaag |
25378513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University