View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10646_low_21 (Length: 209)

Name: NF10646_low_21
Description: NF10646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10646_low_21
NF10646_low_21
[»] chr3 (1 HSPs)
chr3 (87-164)||(25378436-25378513)


Alignment Details
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 87 - 164
Target Start/End: Original strand, 25378436 - 25378513
Alignment:
87 caagactaaacaatccaaattaatgtcaaatgcatactaccatgctatagtggaagcatggtttatcaaacgtggaag 164  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25378436 caagactaaacaatccaaattaatgtcaaatgcatactaccatgctatagtggaagcatggtttatcaaacgtggaag 25378513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University