View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10646_low_4 (Length: 408)
Name: NF10646_low_4
Description: NF10646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10646_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 17 - 398
Target Start/End: Complemental strand, 19924183 - 19923784
Alignment:
| Q |
17 |
acatagcaaggcccactccatccataactatcatatacgggcctcccataaaactgtggggggccaccttgtccaggaccataaacatgcccataaggaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19924183 |
acatagcaaggcccactccatccataactatcatacacgggcctcccataaaactgtggggggccaccttgtccaggaccataaacatgcccgtaaggaa |
19924084 |
T |
|
| Q |
117 |
caactggcgaaggatatgcaagaatggacattggcgctgtctgaggaaacattacagctggtgcagccgcggaaggaagtggagccggtgcctgagccgg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19924083 |
caactggcgaaggatatgcaagaatggacattggcgctgtctgaggaaacattacagctggtgcagccgcggaaggaagtggagccggtgcctgagccgg |
19923984 |
T |
|
| Q |
217 |
ag------------ctggagctggacttggattttgtttaggcgggccaggttgtgcaatcggctttgcctcggccacgggcnnnnnnncttgctctttg |
304 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |||||||| |
|
|
| T |
19923983 |
agctggtgccggagctggagctggacttggattttgtttaggcgggccaggttgtgcaatcggctttgcctcgggcacgggctttttttctggctctttg |
19923884 |
T |
|
| Q |
305 |
gg------tggtgctggcttgggttttggtggttcaactatttctatgcttttgatggtaccacccccttgacaacaaatattgtctcttaccttctctg |
398 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19923883 |
ggcttctcaggtgctggcttgggttttggtggttcaactatttctatgcttttgatggtaccacccccttgacaacaaatattgtctcttaccttctctg |
19923784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 329 - 396
Target Start/End: Original strand, 56012770 - 56012837
Alignment:
| Q |
329 |
ggttcaactatttctatgcttttgatggtaccacccccttgacaacaaatattgtctcttaccttctc |
396 |
Q |
| |
|
||||| || ||||||||||||||||||| ||||| |||| |||||||| |||||||||| |||||| |
|
|
| T |
56012770 |
ggttcgacaatttctatgcttttgatggcaccacaacctttgcaacaaatcttgtctcttatcttctc |
56012837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University