View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10646_low_7 (Length: 337)
Name: NF10646_low_7
Description: NF10646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10646_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 289; Significance: 1e-162; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 17 - 329
Target Start/End: Complemental strand, 12600715 - 12600403
Alignment:
| Q |
17 |
accttcttgtgtccttgaagttttgctattgtggcaaacccatcaccataaaaccacgaatgtaaattctggcactgatcaccatgaacacagctatcat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12600715 |
accttcttgtgtccttgaagttttgctattgtggcaaacccatcaccataaaaccacgaatgtaaattctggcactgatcaccatgaacacagctatcat |
12600616 |
T |
|
| Q |
117 |
tcacccagtacttgcagatacttggtgaagaattctgagaagcctcgacgacgtgtgtcttgttttcatctccggtattatgtttgggaagggaagcctc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
12600615 |
tcacccagtacttgcagatacttggtgaagaattctgagaagcctcgacgacttgtgtctcgttttcatcaccagtattatgtttgggaagggaagcctc |
12600516 |
T |
|
| Q |
217 |
gacaacttgtctagtgtctctttcatctccttcaggctttcttttcaagactgtgtcagtattatgtttgggaaccgaagcctcaacgacttgtgcctta |
316 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
12600515 |
gacaacttgtctagtgtctctttcatcttcttcaggctttcttttcaagactgtgtcagtattatgtttgggaaccgaagcctcaacgacttgtgcctca |
12600416 |
T |
|
| Q |
317 |
tatctttcatctc |
329 |
Q |
| |
|
||||||||||||| |
|
|
| T |
12600415 |
tatctttcatctc |
12600403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 17 - 157
Target Start/End: Original strand, 11044837 - 11044977
Alignment:
| Q |
17 |
accttcttgtgtccttgaagttttgctattgtggcaaacccatcaccataaaaccacgaatgtaaattctggcactgatcaccatgaacacagctatcat |
116 |
Q |
| |
|
|||||||||||||| | ||| |||||||||| || ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
11044837 |
accttcttgtgtccctcaagctttgctattgaggaaaacccatcaccataaaaccatgaatgtaaattctggcactgatcaccatgaacacaactgtcat |
11044936 |
T |
|
| Q |
117 |
tcacccagtacttgcagatacttggtgaagaattctgagaa |
157 |
Q |
| |
|
|||||||||| ||||||||||| |||||| ||||||||| |
|
|
| T |
11044937 |
tcacccagtatttgcagatactcagtgaaggcttctgagaa |
11044977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 192 - 306
Target Start/End: Complemental strand, 12600330 - 12600216
Alignment:
| Q |
192 |
tattatgtttgggaagggaagcctcgacaacttgtctagtgtctctttcatctccttcaggctttcttttcaagactgtgtcagtattatgtttgggaac |
291 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| || || |||||| | || ||||||||||||||||| |
|
|
| T |
12600330 |
tattatgtttgggaagggaagcctcaacaacttgtctagtgtctctatcatctccttcaggcttgctattgaagactatctctgtattatgtttgggaac |
12600231 |
T |
|
| Q |
292 |
cgaagcctcaacgac |
306 |
Q |
| |
|
||||| ||| ||||| |
|
|
| T |
12600230 |
cgaaggctcgacgac |
12600216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University