View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10647_2 (Length: 371)

Name: NF10647_2
Description: NF10647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10647_2
NF10647_2
[»] chr3 (1 HSPs)
chr3 (298-342)||(13206386-13206430)


Alignment Details
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 298 - 342
Target Start/End: Original strand, 13206386 - 13206430
Alignment:
298 tatttaaaagatcacactagttgttttattttttcggggtcaagt 342  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
13206386 tatttaaaagatcacactagttgttttattttttcggggtcaagt 13206430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University