View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10647_low_2 (Length: 292)
Name: NF10647_low_2
Description: NF10647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10647_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 22 - 285
Target Start/End: Original strand, 42151150 - 42151413
Alignment:
| Q |
22 |
gtctcccatctttttatattttagatagataggtgaagattgtggagggttcgacttgaacatttgaagaatagtctccaagtaggtctcacatcaaaat |
121 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42151150 |
gtctcgcatctttttatattttagatagataggtgaagattgtggaggattcgacttgaacatttgaagaatagtctccaagtaggtctcacatcaaaat |
42151249 |
T |
|
| Q |
122 |
cctcaaatcactatagttaaaactctaatccatgcatgagggatgaaagaggagaacccacctcttaattctaggatcgtgatttctcctaaagccttct |
221 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42151250 |
cctcaaatcactgtagttaaaactctaacccatgcatgagggatgaaagaggagaacctacctcttaattctaggatcgtgatttctcctaaagccttct |
42151349 |
T |
|
| Q |
222 |
ctttgctcctagttcctcgaaatctagcnnnnnnnccgattctctcttactattcttcatctca |
285 |
Q |
| |
|
|||||| ||||||||||| ||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
42151350 |
ctttgcacctagttcctccaaatctagcttttttcccgattctctcttactaatcttcatctca |
42151413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 138 - 186
Target Start/End: Original strand, 31370535 - 31370583
Alignment:
| Q |
138 |
ttaaaactctaatccatgcatgagggatgaaagaggagaacccacctct |
186 |
Q |
| |
|
||||||| |||| ||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
31370535 |
ttaaaaccctaacccatgcatgagagatgaaggaggagaacccacctct |
31370583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University