View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1064_low_17 (Length: 207)
Name: NF1064_low_17
Description: NF1064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1064_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 4 - 131
Target Start/End: Original strand, 7450043 - 7450170
Alignment:
| Q |
4 |
aggcgatgcaccttagtctgatggacgttcgatccacgtgtcaatgttggactggttctctagccgtcctaagcaccatccaatcaccaatatgctccat |
103 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7450043 |
aggcgatgcaccttagtttgatggacgttcggtccacgtgtcaatgttggactggttctctagccgtcctaagcaccatccaatcaccaatatgctccat |
7450142 |
T |
|
| Q |
104 |
ttaattgattcgttgacccacatattat |
131 |
Q |
| |
|
||||||||||||||||| |||||||||| |
|
|
| T |
7450143 |
ttaattgattcgttgacgcacatattat |
7450170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 3982885 - 3982938
Alignment:
| Q |
1 |
ttcaggcgatgcaccttagtctgatggacgttcgatccacgtgtcaatgttgga |
54 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| | ||||| |||||| |||||| |
|
|
| T |
3982885 |
ttcaggcgatgtaccttagtttgatggacgtttggtccacatgtcaacgttgga |
3982938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University