View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1064_low_4 (Length: 382)
Name: NF1064_low_4
Description: NF1064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1064_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 107 - 372
Target Start/End: Original strand, 12514093 - 12514355
Alignment:
| Q |
107 |
gaaactataatatttataagnnnnnnnaggccatacttacggttattaaaatcacatatatatagctgttaatacatgaattttgttttactgaacaagt |
206 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12514093 |
gaaactataatatttataagtttttttaggccatacttacggttattaaaatcacatatatatagctgttaatacatgaattttgttttactgaacaagt |
12514192 |
T |
 |
| Q |
207 |
gtatggaatcgtgatagtgctctttcctcctaactaaatttgttttatacaactaaaaaattaaacttattggcctacacacttaactagcaaagtccaa |
306 |
Q |
| |
|
||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12514193 |
gtagtgaatcgtgatagtgctctttcct---aactaaatttgttttatacaactaaaaaattaaacttattggcctacacacttaactagcaaagtccaa |
12514289 |
T |
 |
| Q |
307 |
caactctttctcaatgcaatttaatgcagaaggcaaagagagagacctttgtgagagttttctctg |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12514290 |
caactctttctcaatgcaatttaatgcagaaggcaaagagagagacctttgtgagagttttctctg |
12514355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University