View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10651_high_3 (Length: 289)
Name: NF10651_high_3
Description: NF10651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10651_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 19 - 275
Target Start/End: Complemental strand, 53462511 - 53462255
Alignment:
| Q |
19 |
agagaagggattaatgtggtgcgggtggttggagaaggagcaccataaggagtgcgtgaagggagaggcagcaacgggtcatgatatttggtttgtgtga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53462511 |
agagaagggattaatgtggtgcgggtggttggagaaggagcaccataaggagtgcgtgaagggagaggcagcaacgggtcatgatatttggtttgtgtga |
53462412 |
T |
 |
| Q |
119 |
gttgttatgtggagaaggtgggtatttatatgagagggtttgaagagttatgggttctctttgttgcgttcgtttggttatgggaaaatatctggggtat |
218 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
53462411 |
gttgttatgtagagaaggtgggtatttatatgagagggtttgaagagttatgggttctctttgttgcgttcgtttggttatgggaaagtatctggggtat |
53462312 |
T |
 |
| Q |
219 |
tgaaaattgataattttgaaataatcaactttgattttcagctgagttggactcatt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53462311 |
tgaaaattgataattttgaaataatcaactttgattttcagctgagttggactcatt |
53462255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University