View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10651_high_4 (Length: 264)
Name: NF10651_high_4
Description: NF10651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10651_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 22 - 249
Target Start/End: Original strand, 6966517 - 6966744
Alignment:
| Q |
22 |
gcaatgaaccaatcaaatttctcacctgttggagattgcaagtatgttaaagccattcctcacggaaatggtggctttcttgactcggacactctctttg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6966517 |
gcaatgaaccaatcaaatttctcacctgtttgagattgcaagtatgttaaagccattcctcacggaaatggtggctttcttgactctgacactctctttg |
6966616 |
T |
 |
| Q |
122 |
gatttgctcgtgatttgcctcatagccccagaaggttggtgctttctactagttattttagtttcataccttaaaagtctcatcaacattatgatacata |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6966617 |
gatttgctcgtgatttgcctcatagccccagaaggttggtgctttctactagttattttagtttcataccttaaaagtctcatcaacattatgatacata |
6966716 |
T |
 |
| Q |
222 |
agatattattgaaaccattatagttttt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
6966717 |
agatattattgaaaccattatagttttt |
6966744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 22 - 217
Target Start/End: Original strand, 6958308 - 6958503
Alignment:
| Q |
22 |
gcaatgaaccaatcaaatttctcacctgttggagattgcaagtatgttaaagccattcctcacggaaatggtggctttcttgactcggacactctctttg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6958308 |
gcaatgaaccaatcaaatttctcacctgttggagattgcaagtatgttaaagccattcctcacggaaatggtggctttcttgactctgacactctctttg |
6958407 |
T |
 |
| Q |
122 |
gatttgctcgtgatttgcctcatagccccagaaggttggtgctttctactagttattttagtttcataccttaaaagtctcatcaacattatgata |
217 |
Q |
| |
|
|| |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| ||||| ||||||||||| |
|
|
| T |
6958408 |
gacttgctcgtgatttgcctcgtagccccagaaggttggtgctttctactagttactttagtttcatgccttaaaagtttcatctacattatgata |
6958503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 49 - 83
Target Start/End: Complemental strand, 49101651 - 49101617
Alignment:
| Q |
49 |
gttggagattgcaagtatgttaaagccattcctca |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
49101651 |
gttggagattgcaagtatgttaaagccattcctca |
49101617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University