View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10651_low_14 (Length: 289)
Name: NF10651_low_14
Description: NF10651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10651_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 36 - 279
Target Start/End: Original strand, 41742607 - 41742850
Alignment:
| Q |
36 |
acactaaaatatttctcagtttatcatcgaaaaacctcaattttcacaaccatgaggcttcatgcctaacccaagcaagaacatttttagacaactattc |
135 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41742607 |
acactaaaatacttgtcagtttatcatcgaaaaacctcaattttcacaaccatgaggcttcatgcctaacccaagcaagaacatttttagacaactattc |
41742706 |
T |
|
| Q |
136 |
aaatataacgcttccttttaattaccatccatttgatattactgaataacttctagagcaaaaaggatgccccaaagttttgaagcttaaaattaaattt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41742707 |
aaatataacgcttccttttaattaccatccatttgatattactgaataacttctagagcaaaaaggatgacccaaagttttgaagcttaaaattaaattt |
41742806 |
T |
|
| Q |
236 |
gatttaaaacaaatgattatgattgtttaaatcccctctctgtg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41742807 |
gatttaaaacaaatgattatgattgtttaaatcccctctctgtg |
41742850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 13 - 67
Target Start/End: Original strand, 41742553 - 41742607
Alignment:
| Q |
13 |
catcatgatttgcttgcttatttacactaaaatatttctcagtttatcatcgaaa |
67 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41742553 |
catcttgatttgcttgcttatttacactaaaatatttctcagtttatcatcgaaa |
41742607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University