View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10651_low_16 (Length: 267)
Name: NF10651_low_16
Description: NF10651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10651_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 53639505 - 53639746
Alignment:
| Q |
18 |
acaaacagacacattaatgatcatctttttaccaatactatataatggatatagtctgtaatatttaactcacataaaaaagtcaatactgtgtgtggat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53639505 |
acaaacagacacattaatgatcatctttttaccaatactatataatggatatagtctgtaatatttaactcacataaaaaagtcaatactgtgtgtggat |
53639604 |
T |
 |
| Q |
118 |
tttgtaaaactactctcaatcattttttgaataataacaccacaggcggcttagagtcattttttgactggacnnnnnnnnnnnnnattaagaagactgg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
53639605 |
tttgtaaaactactctcaatcattttttgaataataacaccacaggcggcttagagtcattttttgactggacttttttttttttaat--agaagactgg |
53639702 |
T |
 |
| Q |
218 |
acttctatcttggacgtcnnnnnnntacaaaatatcctttgctt |
261 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
53639703 |
acttctatcttggacgtcaaaataatacaaaatatcctttgctt |
53639746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University