View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10651_low_17 (Length: 267)
Name: NF10651_low_17
Description: NF10651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10651_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 81
Target Start/End: Complemental strand, 3775320 - 3775281
Alignment:
| Q |
42 |
taataagggtgactcaaagtcactatagtattcttaaata |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3775320 |
taataagggtgactcaaagtcactatagtattcttaaata |
3775281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 236
Target Start/End: Complemental strand, 34671703 - 34671630
Alignment:
| Q |
163 |
aatattatcaaccaaccaactccccacccccattcctacaccctcactgatcatgttgatattctaccaccaaa |
236 |
Q |
| |
|
|||| |||||||||| ||||||||||| |||||||| |||||||| ||||| | || ||||||| |||||||| |
|
|
| T |
34671703 |
aatactatcaaccaatcaactccccactcccattccaacaccctctttgatcgtatttatattctgccaccaaa |
34671630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University