View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10651_low_20 (Length: 258)
Name: NF10651_low_20
Description: NF10651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10651_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 223
Target Start/End: Original strand, 5216346 - 5216550
Alignment:
| Q |
19 |
aagttggttgttcaaaacagtgattagattaattagcaaggaagtgtaattatgtaactaattaatcgggtttctgtttcatcgcttaggaaacaagata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5216346 |
aagttggttgttcaaaacagtgattagattaattagcaaggaagtgtaattatgtaactaattaatcgggtttctgtttcattgcttaggaaacaagata |
5216445 |
T |
 |
| Q |
119 |
acggcttcattcgttcctataattatccatattgtttcacgttattatactttgaatatttcaaaactatgtacagcctgtgattatgtgaatctgtatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5216446 |
acggcttcattcgttcctataattatgcatattgtttcacgttattatactttgaatatttcaaaactatgtacagcctgtgattatgtgaatctttatt |
5216545 |
T |
 |
| Q |
219 |
ctttc |
223 |
Q |
| |
|
|||| |
|
|
| T |
5216546 |
gtttc |
5216550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University