View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10651_low_25 (Length: 244)
Name: NF10651_low_25
Description: NF10651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10651_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 37761140 - 37760932
Alignment:
| Q |
1 |
taaagtaatataacacactagatgcccattttttaggatcttgttactattcagttgtcatctttcattttagcatatctcattggtctttggagagaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37761140 |
taaagtaatataacacactagatgcccattttttaggatcttgttactattcagttgtcatctttcattttagcatatcccattggtctttggagagaag |
37761041 |
T |
 |
| Q |
101 |
gctaagtaggtgctttgg-tttattaccttttttcttttataaataataaaaagtttaggtgagatggacctttacaaggtctttacattaatagcggaa |
199 |
Q |
| |
|
||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37761040 |
gctgagtaggtgctttggttttattaccttttttcttttataaataataaaaagtttaggtgagatggacctttacaaggtctttacattaatagtggaa |
37760941 |
T |
 |
| Q |
200 |
tttgatctc |
208 |
Q |
| |
|
||||||||| |
|
|
| T |
37760940 |
tttgatctc |
37760932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University