View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10651_low_26 (Length: 240)
Name: NF10651_low_26
Description: NF10651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10651_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 50465464 - 50465242
Alignment:
| Q |
1 |
ttttacattgtcacaactaatcatacatgtgacttttagaagtaattatgattaaagttaaatgtgattaatgatttaatgggttaattaaccgtnnnnn |
100 |
Q |
| |
|
||||||||| ||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50465464 |
ttttacattatcacaactaatcatacacgtgatttttagaagtaattaatattaaagttaaatgtgattaatgatttaacgggttaattaaccgtaaaaa |
50465365 |
T |
 |
| Q |
101 |
nnnnntctttacatataaattattgggtgaaaagcagaaatatcatatggtatctctccctctatccaaatgacgggttatttattgaatgtgacaggga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50465364 |
aaaaatctttacatataaattattgggtgaaaagcagaaatatcatatggtatctctccctctatccaaatgacgggttatttattgaatgtgacaggga |
50465265 |
T |
 |
| Q |
201 |
tatatagtatatgaggtaaaaac |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
50465264 |
tatatagtatatgaggtaaaaac |
50465242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 85
Target Start/End: Complemental strand, 26491837 - 26491773
Alignment:
| Q |
19 |
aatcatacatgtgacttttagaagtaattatgattaaagttaaatgtgattaatgatttaatgggtt |
85 |
Q |
| |
|
|||||||||||||| || |||||| |||||||| ||| ||||||||||||||| |||||| ||||| |
|
|
| T |
26491837 |
aatcatacatgtga--ttgagaagtgattatgataaaatttaaatgtgattaataatttaaagggtt |
26491773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University