View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10651_low_30 (Length: 213)
Name: NF10651_low_30
Description: NF10651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10651_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 84; Significance: 4e-40; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 22 - 145
Target Start/End: Complemental strand, 2698663 - 2698540
Alignment:
| Q |
22 |
ctatttcttttaaaatggttgatcaatatcgtcaccatcgttgatgtacagttgatatagatatgaatcatttgacagtttgaggttgtgctttggattg |
121 |
Q |
| |
|
||||||| |||||||| ||||||| ||||||||||| || |||||||| ||||||||||| |||||||||||||||||||||||||| ||||||||| || |
|
|
| T |
2698663 |
ctatttcgtttaaaatagttgatcgatatcgtcaccgtcattgatgtatagttgatataggtatgaatcatttgacagtttgaggttttgctttggactg |
2698564 |
T |
 |
| Q |
122 |
taatgcttgaaagggcggtgtctt |
145 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
2698563 |
taatgcttgaaaggacggtgtctt |
2698540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 143 - 201
Target Start/End: Complemental strand, 2698499 - 2698441
Alignment:
| Q |
143 |
cttatgtgtgagtgtttttgtcatagtaaatggtgggtacgtgtgcaattgcttctgtg |
201 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2698499 |
cttatgtgtgggtgttttcgtcatagtaaatggtgggtacgtgtgcaactgcttctgtg |
2698441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University