View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10652_high_2 (Length: 236)
Name: NF10652_high_2
Description: NF10652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10652_high_2 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 14 - 236
Target Start/End: Complemental strand, 38380837 - 38380615
Alignment:
| Q |
14 |
atctccccttcttttgattggattttagttaannnnnnnncccttccttctttgattattttgtcggctcatgatatatacaagacgtagtactagacac |
113 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38380837 |
atctcccctt-ttttgattggattttagttaattttttttcccttccttctttgattattttgtcggctcatgatatatacaagacgtagtactagacac |
38380739 |
T |
 |
| Q |
114 |
tttcttttaatggcaagaaggtagtactagtagtagcttagcctttcgaatttcttcatccattccac-aataatcgatctatttatnnnnnnntattct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
38380738 |
tttcttttaatggcaagaaggtagtactagtagtagcttagcctttcgaatttcttcatccattccacaaataatcgatctatttataaaaaaatattct |
38380639 |
T |
 |
| Q |
213 |
aaaatatttgacattttcattttt |
236 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
38380638 |
aaaatatttgacattttcattttt |
38380615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University