View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10652_low_2 (Length: 312)
Name: NF10652_low_2
Description: NF10652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10652_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 104 - 299
Target Start/End: Complemental strand, 31265993 - 31265798
Alignment:
| Q |
104 |
gttagaaatccattcacatatatcgtttttgacctgttaaataattgacccaccttttaatacccaatgatgattgattgctatgtatctcatgctttga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31265993 |
gttagaaatccattcacatatatcgtttttgacctgttaaataattgacccaccttttaatacccaatgatgattgattgctatgtatctcatgctttga |
31265894 |
T |
|
| Q |
204 |
tttcttgcgcactacctttggagaagtatgatttgatcatatacgaaaggaaaggatggtttctaatcataagttttaatcatttccatttgttct |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31265893 |
tttcttgcgcactacctttggagaagtatgatttgatcatatacgaaaggaaaggatggtttctaatcataagttttaatcatttccatttgttct |
31265798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University