View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10652_low_4 (Length: 251)
Name: NF10652_low_4
Description: NF10652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10652_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 141 - 245
Target Start/End: Complemental strand, 36707268 - 36707164
Alignment:
| Q |
141 |
ttagagcaataagtatacccaacgtttatttgcttgaacaacttgttttacagcatcaatgtactgctcaacagaaggtgatggcatcagcagcctctct |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36707268 |
ttagagcaataagtatacccaacgtttatttgcatgaacaacttgttttacagcatcaatgtactgctcaacagaaggtgatggcatcagcagcctctct |
36707169 |
T |
|
| Q |
241 |
gctcc |
245 |
Q |
| |
|
||||| |
|
|
| T |
36707168 |
gctcc |
36707164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 36707401 - 36707308
Alignment:
| Q |
8 |
actaactacatgtttggtatcacaatgtattttgtctgaaccatagtgactcattatgattctgacaaatacatcgtaataccagacatgcact |
101 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36707401 |
actagctacatgtttggtatcacaatgaattttgtctgaaccatagtcacttattatgattctgacaaatacatcgtaatatcagacatgcact |
36707308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University