View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10652_low_7 (Length: 232)
Name: NF10652_low_7
Description: NF10652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10652_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 217
Target Start/End: Original strand, 24422200 - 24422398
Alignment:
| Q |
18 |
cagaaagttatacggttttttctgttagaaagaatgttacaaaatttggagaaaacggcgttggtgcgttaccaataacatttaagaaattggacggcta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
24422200 |
cagaaagttatacggttttttctgttagaaagaatgttacaaaatttggagaaaacg-cgttggtgcgttaccaataacatttaagaaattggacgacta |
24422298 |
T |
|
| Q |
118 |
agatggatggtaagagaggattggacggttgagatttgattttattggtgatctggtagtttgttgttgatatctatctacgtgcaatgcaatccctatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24422299 |
agatggatggtaagagaggattggacggttgagatttgattttattggtgatctggtagtttgttgttgatatctatctacgtgcaatgcaatccctatg |
24422398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University